You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yabR [2018-02-13T11:49:46.000Z]
similar to polyribonucleotide nucleotidyltransferase
Molecular weight
14.05 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
69,626 → 70,012
The protein
Protein family
S1 motif domain (according to Swiss-Prot)Paralogous protein(s)
Expression and Regulation
Operons
Sigma factors
SigM: sigma factor, PubMed, in SigM regulonSigE: sigma factor, PubMed, in SigE regulonSigW: sigma factor, PubMed, in SigW regulonSigD: sigma factor, PubMed, in SigD regulonSigX: sigma factor, PubMed, in SigX regulon Regulation
view in new tabRegulation
expressed during sporulation (SigE) PubMed and under stress conditions Additional information
there are about 50,000 molecules of DivIC per cell PubMed view in new tabBiological materials
Mutant
MGNA-B919 (yabR::erm), available at the NBRP B. subtilis, JapanBKE00630 (ΔyabR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAABKK00630 (ΔyabR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAAAAAAGTGCTCCTCC, downstream forward: _UP4_TAACTTGCTGCTTTCTATAA References
Loading